hybtech

Identification of diagnostic and prognostic biomarkers, and candidate focused brokers for hepatitis B virus-associated early stage hepatocellular

Identification of diagnostic and prognostic biomarkers, and candidate targeted brokers for hepatitis B virus-associated early stage hepatocellular carcinoma based mostly totally on RNA-sequencing info

 

  • Main liver most cancers is a rapidly progressing neoplasm with extreme morbidity and mortality expenses. The present analysis aimed to find out potential diagnostic and prognostic biomarkers, and candidate targeted brokers for hepatitis B virus (HBV)-associated early stage hepatocellular carcinoma (HCC). The gene expression profiles had been extracted from the Gene Expression Omnibus database.

 

  • Differentially expressed genes (DEGs), hub genes and the enrichment of signaling pathways had been filtered out via a high-throughput sequencing method. The affiliation between hub genes and the outcomes of the irregular expression of hub genes on the pace of genetic variation, whole survival (OS), relapse-free survival (RFS), progression-free survival (PFS) and disease-free survival (DSS) of victims with HCC, along with pathological stage and grade, had been analyzed using fully completely different databases. A whole of 1,582 DEGs had been acknowledged.

 

 

  • Gene Ontology analysis revealed that the DEGs had been primarily involved throughout the ‘oxidation-reduction course of’, ‘steroid metabolic course of’, ‘metabolic course of’ and ‘fatty acid beta-oxidation’. Enrichment analysis of Kyoto Encyclopedia of Genes and Genomes pathways revealed that the DEGs had been primarily associated to ‘metabolic pathways’, ‘PPAR signaling pathway’, ‘fatty acid degradation’ and the ‘cell cycle’.

 

  • A whole of Eight hub genes had been extracted. Furthermore, the irregular expression ranges of hub genes had been intently associated to the OS, RFS, PFS and DSS of victims, the pathological stage and the grade. Furthermore, irregular expression ranges of the Eight hub genes had been current in >30% of all samples.

 

 

  • Plenty of small molecular compounds which can reverse the altered DEGs had been acknowledged based mostly totally on Connectivity Map analysis, along with phenoxybenzamine, GW-8510, resveratrol, 0175029-0000 and daunorubicin. In conclusion, the dysfunction of fat metabolic pathways, the cell cycle, oxidation-reduction processes and viral carcinogenesis may serve important roles throughout the incidence of HBV-associated early stage HCC.
  • The acknowledged Eight hub genes may act as robust biomarkers for prognosis and prognosis. Some small molecular compounds may be promising targeted brokers in opposition to HBV-associated early stage HCC.
hybtech
hybtech

PEG3 Antibody

34056-100ul 100ul
EUR 252.00

PEG3 Antibody

34056-50ul 50ul
EUR 187.00

PEG3 Antibody

43302-100ul 100ul
EUR 252.00

PEG3 Antibody

1-CSB-PA030033
  • EUR 222.00
  • EUR 195.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PEG3. Recognizes PEG3 from Human. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

PEG3 Antibody

CSB-PA022042-
EUR 335.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PEG3. Recognizes PEG3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PEG3 Antibody

CSB-PA022042-100ul 100ul
EUR 316.00
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PEG3. Recognizes PEG3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

PEG3 Antibody

AF9152 200ul
EUR 304.00
Description: PEG3 Antibody detects endogenous levels of total PEG3.

PEG3 Antibody

ABF9152 100 ug
EUR 438.00

Anti-PEG3 Antibody

A02541 100ul
EUR 397.00
Description: Rabbit Polyclonal PEG3 Antibody. Validated in WB and tested in Human.

PEG3 Conjugated Antibody

C34056 100ul
EUR 397.00

PEG3 Polyclonal Antibody

ABP55568-003ml 0.03ml
EUR 158.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090
  • Applications tips:
Description: A polyclonal antibody for detection of PEG3 from Human. This PEG3 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090

PEG3 Polyclonal Antibody

ABP55568-01ml 0.1ml
EUR 289.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090
  • Applications tips:
Description: A polyclonal antibody for detection of PEG3 from Human. This PEG3 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090

PEG3 Polyclonal Antibody

ABP55568-02ml 0.2ml
EUR 414.00
  • Immunogen information: Synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090
  • Applications tips:
Description: A polyclonal antibody for detection of PEG3 from Human. This PEG3 antibody is for WB, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the Internal region of human PEG3 at AA range: 1010-1090

PEG3 Polyclonal Antibody

ES6567-100ul 100ul
EUR 279.00
Description: A Rabbit Polyclonal antibody against PEG3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

PEG3 Polyclonal Antibody

ES6567-50ul 50ul
EUR 207.00
Description: A Rabbit Polyclonal antibody against PEG3 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Anti-PEG3 antibody

STJ114545 100 µl
EUR 277.00
Description: In human, ZIM2 and PEG3 are treated as two distinct genes though they share multiple 5' exons and a common promoter and both genes are paternally expressed (PMID:15203203). Alternative splicing events connect their shared 5' exons either with the remaining 4 exons unique to ZIM2, or with the remaining 2 exons unique to PEG3. In contrast, in other mammals ZIM2 does not undergo imprinting and, in mouse, cow, and likely other mammals as well, the ZIM2 and PEG3 genes do not share exons. Human PEG3 protein belongs to the Kruppel C2H2-type zinc finger protein family. PEG3 may play a role in cell proliferation and p53-mediated apoptosis. PEG3 has also shown tumor suppressor activity and tumorigenesis in glioma and ovarian cells. Alternative splicing of this PEG3 gene results in multiple transcript variants encoding distinct isoforms.

Anti-PEG3 antibody

STJ95024 200 µl
EUR 197.00
Description: Rabbit polyclonal to PEG3.

PEG3 siRNA

20-abx928229
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

PEG3 siRNA

20-abx928230
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

NH2-PEG3

HY-W007545 100mg
EUR 108.00

PEG3 Rabbit pAb

A12671-100ul 100 ul
EUR 308.00

PEG3 Rabbit pAb

A12671-200ul 200 ul
EUR 459.00

PEG3 Rabbit pAb

A12671-20ul 20 ul
EUR 183.00

PEG3 Rabbit pAb

A12671-50ul 50 ul
EUR 223.00

propargyl-PEG3-Acid

20-abx180861
  • EUR 509.00
  • EUR 690.00
  • 0
  • 1
  • Shipped within 1-2 weeks.

N3-PEG3-NH2

20-abx186135
  • EUR 272.00
  • EUR 467.00
  • 0
  • 1
  • Shipped within 1-2 weeks.

N3-PEG3-OH

20-abx186195
  • EUR 370.00
  • EUR 829.00
  • 0
  • 1
  • Shipped within 1-2 weeks.

Alkyne-PEG3-Alkyne

20-abx186246
  • EUR 537.00
  • EUR 829.00
  • 0
  • 1
  • Shipped within 1-2 weeks.

OH-PEG3-CH2CH2COOtBu

20-abx186258
  • EUR 244.00
  • EUR 439.00
  • 0
  • 1
  • Shipped within 1-2 weeks.

Biotin-PEG3-Azide

abx186382-1g 1 g
EUR 787.00
  • Shipped within 1-2 weeks.

Methyl-PEG3-MS

abx186609-250mg 250 mg
EUR 439.00
  • Shipped within 1-2 weeks.

NH2-PEG3-NH2

20-abx186613
  • EUR 300.00
  • EUR 606.00
  • 0
  • 1
  • Shipped within 1-2 weeks.

NH2-PEG3-COOH

20-abx186616
  • EUR 537.00
  • EUR 1595.00
  • 0
  • 1
  • Shipped within 1-2 weeks.

Bromo-PEG3-azide

20-abx186630
  • EUR 370.00
  • EUR 746.00
  • 0
  • 1
  • Shipped within 1-2 weeks.

OH-PEG3-Tos

20-abx085425
  • EUR 648.00
  • EUR 1233.00
  • 0
  • 1
  • Shipped within 1-2 weeks.

Tos-PEG3-Tos

20-abx085426
  • EUR 217.00
  • EUR 272.00
  • 0
  • 1
  • Shipped within 1-2 weeks.

COOH-PEG3-COOH

20-abx085430
  • EUR 676.00
  • EUR 843.00
  • 0
  • 1
  • Shipped within 1-2 weeks.

NHS-PEG3-NHS

ADC-L-121 unit Ask for price

PEG3 Blocking Peptide

AF9152-BP 1mg
EUR 195.00

VH032-PEG3-acetylene

HY-128767 5mg
EUR 113.00

Azido-PEG3-FLAG

H-7924.0500 0.5mg
EUR 383.00
Description: Sum Formula: C50H75N13O24

Azido-PEG3-FLAG

H-7924.1000 1.0mg
EUR 618.00
Description: Sum Formula: C50H75N13O24

N3-PEG3-CH2COOH

HY-42637 100mg
EUR 153.00

Amine-PEG3-Biotin

HY-111377 10mg
EUR 211.00

Boc-NH-PEG3

HY-W017772 100mg
EUR 142.00

Paternally Expressed 3 (PEG3) Antibody

20-abx013786
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Paternally Expressed 3 (PEG3) Antibody

abx331093-100ul 100 ul
EUR 425.00
  • Shipped within 5-10 working days.

Paternally Expressed 3 (PEG3) Antibody

20-abx323448
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

PEG3-tetrazine, 1 g

1978-1g 1 g
EUR 661.00

PEG3-tetrazine, 250 mg

1978-250mg 250 mg
EUR 305.00

Fmoc-nh-peg3-ch2cooh

20-abx180768
  • EUR 495.00
  • EUR 4114.00
  • EUR 1274.00
  • 0
  • 1
  • 2
  • Shipped within 1-2 weeks.

Boc-NH-PEG3-NH2

20-abx180877
  • EUR 551.00
  • EUR 1219.00
  • 0
  • 1
  • Shipped within 1-2 weeks.

Bis-PEG3-NHS Ester

ADC-L-120 unit Ask for price

Mouse PEG3 shRNA Plasmid

20-abx971994
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Human PEG3 shRNA Plasmid

20-abx953456
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

NH2-PEG3-C1-Boc

HY-128801 100mg
EUR 131.00

Azide-PEG3-Azide, 1 g

207-1g 1 g
EUR 101.00

Azide-PEG3-Azide, 5 g

207-5g 5 g
EUR 320.00

Azide-PEG3-Amine, 1 g

218-1g 1 g
EUR 93.00

Azide-PEG3-Amine, 5 g

218-5g 5 g
EUR 230.00

PEG3 dicarboxylic acid, 10 g

1715-10g 10 g
EUR 910.00

PEG3 dicarboxylic acid, 1 g

1715-1g 1 g
EUR 353.00

PEG3 dicarboxylic acid, 5 g

1715-5g 5 g
EUR 613.00

Alkyne-PEG3-COOH, 1 g

1743-1g 1 g
EUR 349.00

Alkyne-PEG3-COOH, 5 g

1743-5g 5 g
EUR 661.00

Alkyne-PEG3-OH, 1 g

418-1g 1 g
EUR 93.00

Alkyne-PEG3-OH, 5 g

418-5g 5 g
EUR 230.00

Biotin PEG3 azide, 25 mg

D3730 25 mg
EUR 97.00

Biotin PEG3 azide, 50 mg

E3730 50 mg
EUR 130.00

Biotin PEG3 azide, 10 mg

C3730 10 mg
EUR 60.00

N3-PEG3-C2-NHS ester

HY-126528 500mg
EUR 3264.00

Pomalidomide-PEG3-C2-NH2 (TFA)

HY-128716A 2g
EUR 5675.00

NHPI-PEG3-C2-Pfp ester

HY-130092 100mg
EUR 843.00

NHPI-PEG3-C2-NHS ester

HY-130093 100mg
EUR 843.00

NH2-PEG3-C2-NH-Boc

HY-42776 100mg
EUR 108.00

N3-PEG3-vc-PAB-MMAE

HY-100874 5mg
EUR 1221.00

Biotin PEG3 azide, 100 mg

F3730 100 mg
EUR 156.00

PEG3 ORF Vector (Human) (pORF)

ORF027601 1.0 ug DNA
EUR 659.00

Peg3 ORF Vector (Mouse) (pORF)

ORF053769 1.0 ug DNA
EUR 1572.00

TMP-PEG3-amine, trifluoroacetic acid salt

91056 1MG
EUR 195.00
Description: Minimum order quantity: 1 unit of 1MG

Ald-Ph-amido-PEG3-C-COOH

HY-130098 100mg
EUR 578.00

Ald-Ph-amido-PEG3-C1-Boc

HY-130100 100mg
EUR 843.00

(S,R,S)-AHPC-PEG3-N3

HY-103598 2g
EUR 5675.00

(S,R,S)-AHPC-PEG3-NH2

HY-103602A 1g
EUR 3896.00

Thalidomide-O-amido-PEG3-C2-NH2

HY-107440 2g
EUR 5675.00

Peg3 sgRNA CRISPR Lentivector set (Mouse)

K4341801 3 x 1.0 ug
EUR 339.00

PEG3 sgRNA CRISPR Lentivector set (Human)

K1626501 3 x 1.0 ug
EUR 339.00

PEG3-AS1 ORF Vector (Human) (pORF)

ORF027602 1.0 ug DNA Ask for price

Ald-Ph-amido-PEG3-C2-Pfp ester

HY-130102 100mg
EUR 843.00

(S,R,S)-AHPC-PEG3-NH2 (hydrochloride)

HY-103602 25mg
EUR 234.00

Thalidomide-O-amido-PEG3-C2-NH2 (TFA)

HY-103611 2g
EUR 5675.00

Peg3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4341802 1.0 ug DNA
EUR 154.00

Peg3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4341803 1.0 ug DNA
EUR 154.00

Peg3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4341804 1.0 ug DNA
EUR 154.00

PEG3 sgRNA CRISPR Lentivector (Human) (Target 1)

K1626502 1.0 ug DNA
EUR 154.00

PEG3 sgRNA CRISPR Lentivector (Human) (Target 2)

K1626503 1.0 ug DNA
EUR 154.00

PEG3 sgRNA CRISPR Lentivector (Human) (Target 3)

K1626504 1.0 ug DNA
EUR 154.00

PEG3 Protein Vector (Human) (pPB-C-His)

PV110402 500 ng
EUR 2280.00

PEG3 Protein Vector (Human) (pPB-N-His)

PV110403 500 ng
EUR 2280.00

PEG3 Protein Vector (Human) (pPM-C-HA)

PV110404 500 ng
EUR 2280.00

PEG3 Protein Vector (Human) (pPM-C-His)

PV110405 500 ng
EUR 2280.00

PEG3 Protein Vector (Mouse) (pPB-C-His)

PV215074 500 ng
EUR 2646.00

PEG3 Protein Vector (Mouse) (pPB-N-His)

PV215075 500 ng
EUR 2646.00

PEG3 Protein Vector (Mouse) (pPM-C-HA)

PV215076 500 ng
EUR 2646.00

PEG3 Protein Vector (Mouse) (pPM-C-His)

PV215077 500 ng
EUR 2646.00

Peg3 3'UTR Luciferase Stable Cell Line

TU116185 1.0 ml Ask for price

Peg3 3'UTR GFP Stable Cell Line

TU166185 1.0 ml Ask for price

PEG3 3'UTR GFP Stable Cell Line

TU067722 1.0 ml
EUR 2333.00

PEG3 3'UTR Luciferase Stable Cell Line

TU017722 1.0 ml
EUR 2333.00

Anti-ERBB2 (trastuzumab)-Amino-PEG3-Propionyl-MMAE ADC

ADC-W-629 1mg Ask for price
Description: This ADC product is comprised of an engineerd anti-ERBB2 antibody (trastuzumab with LLQGG tag at Fc) conjugated via a Amino-PEG3-Propionyl linker to MMAE

(S,R,S)-AHPC-C6-PEG3-C4-Cl

HY-103605 1g
EUR 3896.00

Mouse Paternally- expressed gene 3 protein, Peg3 ELISA KIT

ELI-20913m 96 Tests
EUR 865.00

Human Paternally- expressed gene 3 protein, PEG3 ELISA KIT

ELI-22084h 96 Tests
EUR 824.00

Bovine Paternally- expressed gene 3 protein, PEG3 ELISA KIT

ELI-45910b 96 Tests
EUR 928.00

PEG3-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV772727 1.0 ug DNA Ask for price

PEG3-AS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV772731 1.0 ug DNA Ask for price

PEG3-AS1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV772732 1.0 ug DNA Ask for price

Peg3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4341805 3 x 1.0 ug
EUR 376.00

PEG3 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1626505 3 x 1.0 ug
EUR 376.00

Peg3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4341808 1.0 ug DNA
EUR 167.00

Peg3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4341806 1.0 ug DNA
EUR 167.00

Peg3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4341807 1.0 ug DNA
EUR 167.00

PEG3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1626506 1.0 ug DNA
EUR 167.00

PEG3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1626507 1.0 ug DNA
EUR 167.00

PEG3 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1626508 1.0 ug DNA
EUR 167.00

PEG3-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV772729 1.0 ug DNA Ask for price

PEG3-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV772730 1.0 ug DNA Ask for price

H2B Antibody Antibody

AF4659 200ul
EUR 376.00
Description: H2B Antibody Antibody detects endogenous levels of H2B.

CD11b Antibody Antibody

ABD2911 100 ug
EUR 438.00

anti- Antibody^Polyclonal antibody control antibody

LSMab09882 100 ug
EUR 438.00

Ly1 Antibody Reactive (LYAR) Antibody

20-abx008109
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

20-abx004855
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

20-abx123734
  • EUR 411.00
  • EUR 592.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

abx036399-100ug 100 ug
EUR 391.00
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

20-abx014333
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx033330-400ul 400 ul
EUR 523.00
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx033330-80l 80 µl
EUR 286.00
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

20-abx319900
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

20-abx319901
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

20-abx319905
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Anti-Glycoprotein Antibody (GP) Antibody

20-abx319913
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

abx234901-100ug 100 ug
EUR 551.00
  • Shipped within 5-12 working days.

Ly1 Antibody Reactive (LYAR) Antibody

20-abx324434
  • EUR 314.00
  • EUR 244.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive (LYAR) Antibody

20-abx311665
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-10 working days.

Anti-Glycolipid Antibody (AGA) Antibody

abx230204-100ug 100 ug
EUR 481.00
  • Shipped within 5-12 working days.

Anti-Anti-SEPT6 antibody antibody

STJ11100949 100 µl
EUR 277.00
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis. One version of pediatric acute myeloid leukemia is the result of a reciprocal translocation between chromosomes 11 and X, with the breakpoint associated with the genes encoding the mixed-lineage leukemia and septin 2 proteins. This gene encodes four transcript variants encoding three distinct isoforms. An additional transcript variant has been identified, but its biological validity has not been determined.

Anti-Anti-SEPT9 Antibody antibody

STJ111369 100 µl
EUR 277.00
Description: This gene is a member of the septin family involved in cytokinesis and cell cycle control. This gene is a candidate for the ovarian tumor suppressor gene. Mutations in this gene cause hereditary neuralgic amyotrophy, also known as neuritis with brachial predilection. A chromosomal translocation involving this gene on chromosome 17 and the MLL gene on chromosome 11 results in acute myelomonocytic leukemia. Multiple alternatively spliced transcript variants encoding different isoforms have been described.

Anti-Anti-SEPT11 Antibody antibody

STJ111530 100 µl
EUR 277.00

Anti-Anti-SEPT4 Antibody antibody

STJ112276 100 µl
EUR 277.00
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is highly expressed in brain and heart. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. One of the isoforms (known as ARTS) is distinct; it is localized to the mitochondria, and has a role in apoptosis and cancer.

Anti-Anti-SEPT2 Antibody antibody

STJ25475 100 µl
EUR 277.00

Anti-Anti-SEPT5 Antibody antibody

STJ25477 100 µl
EUR 277.00
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-SEPT8 Antibody antibody

STJ25479 100 µl
EUR 277.00
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT2 Antibody antibody

STJ28365 100 µl
EUR 277.00

Anti-Anti-SEPT7 Antibody antibody

STJ28963 100 µl
EUR 277.00
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-MARCH9 Antibody antibody

STJ112609 100 µl
EUR 277.00

Anti-Anti-SEPT11 Antibody antibody

STJ113941 100 µl
EUR 277.00

Anti-Anti-SEPT11 Antibody antibody

STJ114081 100 µl
EUR 277.00

Anti-Anti-SEPT5 Antibody antibody

STJ114819 100 µl
EUR 277.00
Description: This gene is a member of the septin gene family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. This gene is mapped to 22q11, the region frequently deleted in DiGeorge and velocardiofacial syndromes. A translocation involving the MLL gene and this gene has also been reported in patients with acute myeloid leukemia. Alternative splicing results in multiple transcript variants. The presence of a non-consensus polyA signal (AACAAT) in this gene also results in read-through transcription into the downstream neighboring gene (GP1BB; platelet glycoprotein Ib), whereby larger, non-coding transcripts are produced.

Anti-Anti-MARCH8 Antibody antibody

STJ114828 100 µl
EUR 277.00

Anti-Anti-SEPT7 Antibody antibody

STJ116214 100 µl
EUR 277.00
Description: This gene encodes a protein that is highly similar to the CDC10 protein of Saccharomyces cerevisiae. The protein also shares similarity with Diff 6 of Drosophila and with H5 of mouse. Each of these similar proteins, including the yeast CDC10, contains a GTP-binding motif. The yeast CDC10 protein is a structural component of the 10 nm filament which lies inside the cytoplasmic membrane and is essential for cytokinesis. This human protein functions in gliomagenesis and in the suppression of glioma cell growth, and it is required for the association of centromere-associated protein E with the kinetochore. Alternative splicing results in multiple transcript variants. Several related pseudogenes have been identified on chromosomes 5, 7, 9, 10, 11, 14, 17 and 19.

Anti-Anti-SEPT8 Antibody antibody

STJ117206 100 µl
EUR 277.00
Description: This gene is a member of the septin family of nucleotide binding proteins, originally described in yeast as cell division cycle regulatory proteins. Septins are highly conserved in yeast, Drosophila, and mouse, and appear to regulate cytoskeletal organization. Disruption of septin function disturbs cytokinesis and results in large multinucleate or polyploid cells. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-SEPT12 Antibody antibody

STJ117759 100 µl
EUR 277.00
Description: This gene encodes a guanine-nucleotide binding protein and member of the septin family of cytoskeletal GTPases. Septins play important roles in cytokinesis, exocytosis, embryonic development, and membrane dynamics. Multiple transcript variants encoding different isoforms have been found for this gene.

Anti-Anti-MARCH6 Antibody antibody

STJ118549 100 µl
EUR 277.00

Anti-Anti-MARCH6 Antibody antibody

STJ118550 100 µl
EUR 277.00

Anti-Anti-MARCH7 Antibody antibody

STJ118752 100 µl
EUR 277.00

Anti-Anti-SEPT3 Antibody antibody

STJ118990 100 µl
EUR 277.00

Anti-Anti-SEPT1 antibody antibody

STJ119580 100 µl
EUR 277.00
Description: This gene is a member of the septin family of GTPases. Members of this family are required for cytokinesis and the maintenance of cellular morphology. This gene encodes a protein that can form homo- and heterooligomeric filaments, and may contribute to the formation of neurofibrillary tangles in Alzheimer's disease. Alternatively spliced transcript variants have been found but the full-length nature of these variants has not been determined. [provided by RefSeq, Dec 2012]

Cytokeratin 7 antibody-Cytoskeleton Marker Antibody

48169-100ul 100ul
EUR 333.00

Cytokeratin 7 antibody-Cytoskeleton Marker Antibody

48169-50ul 50ul
EUR 239.00

Antibody Pair to ApoA-V antibody

10R-1876 100 ul
EUR 651.00
Description: Mouse monoclonal Antibody Pair to ApoA-V antibody

Anti CD22 Antibody: CD22 Monoclonal Antibody

065-A-01mg 0,1 mg
EUR 267.50
  • Category: Antibody, Signal Transduction Antibodies, mAb
Description: anti-CD22 monoclonal antibody

Anti CD22 Antibody: CD22 Monoclonal Antibody

065-A-1000ug 1000 ug
EUR 1282.50
  • Category: Antibody, Signal Transduction Antibodies, mAb
Description: anti-CD22 monoclonal antibody

Hepatitis C Virus Antibody (HCV) Antibody

abx023924-1mg 1 mg
EUR 1205.00
  • Shipped within 5-10 working days.

Ly1 Antibody Reactive Homolog (LYAR) Antibody

20-abx103034
  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Ly1 Antibody Reactive Homolog (LYAR) Antibody

20-abx103035
  • EUR 467.00
  • EUR 133.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

 

 

SUMO4 small interfering RNA attenuates invasion and migration via the JAK2/STAT3 pathway in non-small cell lung most cancers cells

 

  • Small ubiquitin-like modifier 4 (SUMO4) is the latest member of the sumoylation family, which boosts the stability of protein, regulates the distribution and localization of the protein, and impacts the transcription train of the protein. Nonetheless, the operate of SUMO4 in non-small cell lung most cancers (NSCLC) has not however been reported.
  • The present analysis first demonstrated that SUMO4 was upregulated in numerous tissues from victims with NSCLC. Immunohistochemistry was carried out to show the expression diploma of SUMO4 in lung most cancers tumor tissues. Following the transfection, The EMT standing and signaling pathway activation regulated by SUMO4-siRNA was assessed by western blotting.
  • The Transwell and wound therapeutic assays had been carried out to analysis the regulatory impression of SUMO4-siRNA on cell migration and invasion. Cell Counting Gear-Eight assay was carried out to analysis whether or not or not SUMO4-siRNA affected the chemosensitivity of the NSCLC cells to cisplatin. Statistical analysis of immunohistochemical outcomes from the tissues confirmed that the overexpression of SUMO4 was significantly associated to intercourse, tumor type, historic previous of smoking, T stage and poor prognosis.
  • It was moreover acknowledged that SUMO4 small interfering RNA attenuated invasion and migration in NSCLC cell traces, as successfully chemosensitivity to cisplatin via the inhibition of the JAK2/STAT3 pathway. In conclusion, SUMO4 may play an important operate throughout the poor prognosis of victims with NSCLC. The present analysis signifies that SUMO4 may be a attainable therapeutic purpose for NSCLC.

 

Low-cost RNA extraction method for terribly scalable transcriptome analysis

 

RNA extraction has been improved by integration of numerous provides throughout the protocol, akin to phenol, guanidine thiocyanate, and silica, consistent with the case-specific requires. Nonetheless, few methods have been designed for high-throughput RNA preparation for large-scale transcriptome analysis. On this analysis, we established a high-throughput guanidinium thiocyanate and isopropyl alcohol based RNA extraction method (HighGI).

HighGI depends on straightforward and phenol-free do-it-yourself buffers and the related charge is significantly lower than a column-based enterprise package deal. We demonstrated that the usual and quantity of RNA extracted with HighGI had been corresponding to those extracted with a typical phenol/chloroform-based method and a column-based enterprise package deal. HighGI retained small RNAs decrease than 200 bp, which might be misplaced with a enterprise column-based package deal.

We moreover demonstrated that HighGI is rapidly related to semi-automated RNA extraction. HighGI permits high-throughput RNA extraction for large-scale RNA preparation with extreme yield and prime quality.

 

Developmental validation of the Yfiler Platinum PCR Amplification Package for forensic genetic caseworks and databases

 

Y chromosome kits have been efficiently utilized in circumstances the place human organic materials exists. With the event of genotyping capacity, extra Y chromosomal markers are wanted for finer identification of male people and lineages. On this examine, we performed a developmental validation of a newly emerged Y chromosome equipment that mixes two completely different sorts of markers: 38 Y-chromosome quick tandem repeats and three Y-indels.
The outcomes present that this equipment has excessive sensitivity when there’s a small quantity of DNA (125 pg), multiple male (minor:main = 1:7), or a combination of men and women (male:feminine = 125pg:1875pg), inhibited substances (800 μM hematin and greater than 1600 ng/μL humic acid).
The equipment reveals excessive precision stage with a regular deviation of allele dimension not more than 0.14 nt. Locus DYS481 exhibits the most important stutter charge, with three stutters per true allele. Inhabitants samples are properly recognized (match chance of 0.001106), and mutations could be noticed in father-son pairs (46 mutations in 70 pairs, 10 in locus DYS627). Out of all of the inhabitants samples, 13.2% belonged to haplogroup M117-O2a2b1a1, with their ethnic group being Han Chinese language.
The outcomes present that this equipment can enhance the efficiency of figuring out male people, acquiring extra distinctive haplotypes (rising from 894 to 918 of 1000 male samples) and better discrimination capability (rising from 0.942 to 0.955) on this examine in comparison with earlier extensively used Yfiler Plus equipment. Apart from, it provides details about their paternal lineages in forensic genetic casework and genealogical database development. This text is protected by copyright. All rights reserved.

 

Anti-CGA antibody

STJ23110 100 µl
EUR 277.00
Description: The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. The protein encoded by this gene is the alpha subunit and belongs to the glycoprotein hormones alpha chain family. Two transcript variants encoding different isoforms have been found for this gene.

Rabbit Polyclonal antibody Anti-CRBN

Anti-CRBN 50 µg
EUR 349.00

Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit

DLR-CGa-Hu-48T 48T
EUR 498.00
  • Should the Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Chorionic Gonadotropin Alpha Polypeptide (CGa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit

DLR-CGa-Hu-96T 96T
EUR 647.00
  • Should the Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Chorionic Gonadotropin Alpha Polypeptide (CGa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit

RD-CGa-Hu-48Tests 48 Tests
EUR 500.00

Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit

RD-CGa-Hu-96Tests 96 Tests
EUR 692.00

Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit

RDR-CGa-Hu-48Tests 48 Tests
EUR 522.00

Human Chorionic Gonadotropin Alpha Polypeptide (CGa) ELISA Kit

RDR-CGa-Hu-96Tests 96 Tests
EUR 724.00

CGA Antibody

ABD6371 100 ug
EUR 438.00

CGA Antibody

32250-100ul 100ul
EUR 252.00

CgA antibody

10R-2291 1 mL
EUR 584.00
Description: Mouse monoclonal CgA antibody

CGA Antibody

DF6371 200ul
EUR 304.00
Description: CGA Antibody detects endogenous levels of total CGA.

CGA Antibody

CSB-PA005293KA01HU-
EUR 335.00
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against CGA. Recognizes CGA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

CGA Antibody

CSB-PA005293KA01HU-100ul 100ul
EUR 389.00
  • Form: liquid
  • Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against CGA. Recognizes CGA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

CGA Antibody

1-CSB-PA292680
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CGA. Recognizes CGA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

CGA Antibody

1-CSB-PA131153
  • EUR 317.00
  • EUR 244.00
  • 0
  • 1
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against CGA. Recognizes CGA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

CGA Conjugated Antibody

C32250 100ul
EUR 397.00

CgA/ Rat CgA ELISA Kit

ELA-E1212r 96 Tests
EUR 886.00

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC611060-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF660R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC611060-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF660R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC401060-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF640R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC401060-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF640R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC431060-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF543 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC431060-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF543 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC471060-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF647 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC471060-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF647 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC551060-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF555 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC551060-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF555 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC051060-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF405M conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC051060-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF405M conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC041060-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF405S conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC041060-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF405S conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNUB1060-100 100uL
EUR 209.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Concentration: 0.2mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNUB1060-500 500uL
EUR 458.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Concentration: 0.2mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNUM1060-50 50uL
EUR 395.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), 1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC681060-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF568 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC681060-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF568 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC701060-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF770 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC701060-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF770 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC941060-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF594 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC941060-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF594 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNCH1060-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNCH1060-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC801060-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF680 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC801060-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF680 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNCP1060-250 250uL
EUR 383.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), PerCP conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNCR1060-250 250uL
EUR 383.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), RPE conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNCA1060-250 250uL
EUR 383.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), APC conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNCAP1060-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNCAP1060-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNCB1060-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Biotin conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNCB1060-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), Biotin conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC881060-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF488A conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC881060-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF488A conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC811060-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF680R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA414 + CGA/777 + CGA/798) Antibody

BNC811060-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA414 + CGA/777 + CGA/798), CF680R conjugate, Concentration: 0.1mg/mL

Polyclonal Goat anti-GST α-form

GST-ANTI-1 50 uL
EUR 280.00

Polyclonal Goat anti-GST μ-form

GST-ANTI-2 50 uL
EUR 280.00

Polyclonal Goat anti-GST p-form

GST-ANTI-3 50 uL
EUR 280.00

CGA siRNA

20-abx911610
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

CGA siRNA

20-abx911611
  • EUR 551.00
  • EUR 732.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Polyclonal CGA / hCG Alpha Antibody

APG02559G 0.1mg
EUR 484.00
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human CGA / hCG Alpha . This antibody is tested and proven to work in the following applications:

Monoclonal CGA Antibody, Clone: 2E6B3

APG02561G 0.1ml
EUR 528.00
Description: A Monoclonal antibody against Human CGA. The antibodies are raised in Mouse and are from clone 2E6B3. This antibody is applicable in WB, E

Monoclonal CGA Antibody, Clone: EP3373

APG02562G 0.1ml
EUR 528.00
Description: A Monoclonal antibody against Human CGA. The antibodies are raised in Rabbit and are from clone EP3373. This antibody is applicable in WB and IHC

Chromogranin A(CGA/414) Antibody

BNC610414-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), CF660R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC610414-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), CF660R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC680414-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), CF568 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC680414-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), CF568 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC400414-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), CF640R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC400414-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), CF640R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC430414-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), CF543 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC430414-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), CF543 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC550414-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), CF555 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC550414-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), CF555 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC040414-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), CF405S conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC040414-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), CF405S conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC050414-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), CF405M conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC050414-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), CF405M conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC470414-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), CF647 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC470414-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), CF647 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNUM0414-50 50uL
EUR 395.00
Description: Primary antibody against Chromogranin A(CGA/414), 1mg/mL

Chromogranin A(CGA/414) Antibody

BNC700414-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), CF770 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC700414-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), CF770 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC940414-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), CF594 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC940414-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), CF594 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNCH0414-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNCH0414-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC800414-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), CF680 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC800414-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), CF680 conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC810414-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), CF680R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC810414-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), CF680R conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNCP0414-250 250uL
EUR 383.00
Description: Primary antibody against Chromogranin A(CGA/414), PerCP conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNCR0414-250 250uL
EUR 383.00
Description: Primary antibody against Chromogranin A(CGA/414), RPE conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNCA0414-250 250uL
EUR 383.00
Description: Primary antibody against Chromogranin A(CGA/414), APC conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNCAP0414-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNCAP0414-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNCB0414-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), Biotin conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNCB0414-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), Biotin conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC880414-100 100uL
EUR 199.00
Description: Primary antibody against Chromogranin A(CGA/414), CF488A conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNC880414-500 500uL
EUR 544.00
Description: Primary antibody against Chromogranin A(CGA/414), CF488A conjugate, Concentration: 0.1mg/mL

Chromogranin A(CGA/414) Antibody

BNUB0414-100 100uL
EUR 209.00
Description: Primary antibody against Chromogranin A(CGA/414), Concentration: 0.2mg/mL

Chromogranin A(CGA/414) Antibody

BNUB0414-500 500uL
EUR 458.00
Description: Primary antibody against Chromogranin A(CGA/414), Concentration: 0.2mg/mL

CGA cloning plasmid

CSB-CL005293HU1-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 351
  • Sequence: atggattactacagaaaatatgcagctatctttctggtcacattgtcggtgtttctgcatgttctccattccgctcctgatgtgcaggattgcccagaatgcacgctacaggaaaacccactcttctcccagccgggtgccccaatacttcagtgcatgggctgctgcttctctag
  • Show more
Description: A cloning plasmid for the CGA gene.

CGA cloning plasmid

CSB-CL005293HU2-10ug 10ug
EUR 233.00
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 351
  • Sequence: atggattactacagaaaatatgcagctatctttctggtcacattgtcggtgtttctgcatgttctccattccgctcctgatgtgcaggattgcccagaatgcacgctacaggaaaacccattcttctcccagccgggtgccccaatacttcagtgcatgggctgctgcttctctag
  • Show more
Description: A cloning plasmid for the CGA gene.

CGA Rabbit pAb

A1239-100ul 100 ul
EUR 308.00

CGA Rabbit pAb

A1239-200ul 200 ul
EUR 459.00

CGA Rabbit pAb

A1239-20ul 20 ul
EUR 183.00

CGA Rabbit pAb

A1239-50ul 50 ul
EUR 223.00

CGA Blocking Peptide

DF6371-BP 1mg
EUR 195.00

Anti-Chromogranin A/ CHGA Antibody Clone CGA/414, Unconjugated-100ug

1113-MSM1-P1 100ug
EUR 428.00

Anti-Chromogranin A/ CHGA Antibody Clone CGA/413, Unconjugated-100ug

1113-MSM9-P1 100ug
EUR 428.00

Glycoprotein Hormones Alpha Chain (CGA) Antibody

abx117075-100ug 100 ug
EUR 467.00
  • Shipped within 5-10 working days.

Glycoprotein Hormones Alpha Chain (CGA) Antibody

20-abx001151
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • Shipped within 5-10 working days.

Chorionic Gonadotropin Alpha Polypeptide (CGa) Antibody

20-abx104052
  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Chorionic Gonadotropin Alpha Polypeptide (CGa) Antibody

20-abx104053
  • EUR 300.00
  • EUR 133.00
  • EUR 801.00
  • EUR 425.00
  • EUR 258.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-12 working days.

Glycoprotein Hormones Alpha Chain (CGA) Antibody

abx215829-100ug 100 ug
EUR 439.00
  • Shipped within 5-10 working days.

Glycoprotein Hormones Alpha Chain (CGA) Antibody

abx224103-100ug 100 ug
EUR 411.00
  • Shipped within 5-10 working days.

Glycoprotein Hormones Alpha Chain (CGA) Antibody

20-abx210782
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Glycoprotein Hormones Alpha Chain (CGA) Antibody

20-abx210783
  • EUR 411.00
  • EUR 300.00
  • 0
  • 1
  • Shipped within 5-10 working days.

Glycoprotein Hormones Alpha Chain (CGA) Antibody

20-abx225107
  • EUR 370.00
  • EUR 606.00
  • EUR 314.00
  • 0
  • 1
  • 2
  • Shipped within 5-10 working days.

Chorionic Gonadotropin Alpha Polypeptide (CGa) Antibody

20-abx171737
  • EUR 328.00
  • EUR 815.00
  • EUR 425.00
  • EUR 154.00
  • EUR 258.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-12 working days.

Human CGA ELISA Kit

ELA-E0441h 96 Tests
EUR 824.00

CGA ELISA KIT|Human

EF004143 96 Tests
EUR 689.00

Human CGA shRNA Plasmid

20-abx950777
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

Mouse CGA shRNA Plasmid

20-abx969656
  • EUR 801.00
  • EUR 1121.00
  • 0
  • 1
  • Shipped within 15-20 working days.

CGA Recombinant Protein (Human)

RP006901 100 ug Ask for price

CGA Recombinant Protein (Human)

RP006904 100 ug Ask for price

CGA Recombinant Protein (Rat)

RP194735 100 ug Ask for price

CGA Recombinant Protein (Mouse)

RP123761 100 ug Ask for price

Human CGA ELISA Kit

STJ150209 1 kit
EUR 412.00
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of HCG in human serum, plasma and other biological fluids

Anti-Chromogranin A / CHGA Antibody (CGA/413 + CHGA/777 + CHGA/798)

A1576-100
EUR 479.00

Chorionic Gonadotropin Alpha Polypeptide (CGa) Antibody (FITC)

20-abx273928
  • EUR 495.00
  • EUR 258.00
  • EUR 1455.00
  • EUR 676.00
  • EUR 398.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-15 working days.

Chorionic Gonadotropin Alpha Polypeptide (CGa) Antibody (Biotin)

20-abx272165
  • EUR 439.00
  • EUR 244.00
  • EUR 1261.00
  • EUR 606.00
  • EUR 328.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-7 working days.

Chorionic Gonadotropin Alpha Polypeptide (CGa) Antibody (Biotin)

20-abx272885
  • EUR 467.00
  • EUR 244.00
  • EUR 1344.00
  • EUR 634.00
  • EUR 342.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Shipped within 5-15 working days.

Anti-Chromogranin A/ CHGA Antibody Clone LK2H10 + PHE5 + CGA/414, Unconjugated-100ug

1113-MSM5-P1 100ug
EUR 428.00

Rat Chromogranin(CgA)ELISA Kit

GA-E0565RT-48T 48T
EUR 317.00

Rat Chromogranin(CgA)ELISA Kit

GA-E0565RT-96T 96T
EUR 496.00

Human Chromogranin,CgA ELISA Kit

201-12-1731 96 tests
EUR 440.00
  • This Chromogranin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Chromogranin A (CgA) ELISA Kit

K4241-100
EUR 914.00

Human Chromogranin,CgA ELISA Kit

CN-04332H1 96T
EUR 486.00

Human Chromogranin,CgA ELISA Kit

CN-04332H2 48T
EUR 336.00

Human Chromogranin, CgA ELISA Kit

CSB-E09153h-24T 1 plate of 24 wells
EUR 165.00
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Chromogranin, CgA in samples from serum, plasma, cell culture supernates, urine, cerebrospinalfluid (CSF). A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Chromogranin, CgA ELISA Kit

1-CSB-E09153h
  • EUR 900.00
  • EUR 5476.00
  • EUR 2900.00
  • 0
  • 1
  • 2
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Chromogranin, CgA in samples from serum, plasma, cell culture supernates, urine, cerebrospinalfluid(CSF). Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

CGA ORF Vector (Human) (pORF)

ORF002301 1.0 ug DNA
EUR 95.00

CGA ORF Vector (Human) (pORF)

ORF002302 1.0 ug DNA
EUR 95.00

Cga ORF Vector (Mouse) (pORF)

ORF041255 1.0 ug DNA
EUR 506.00

Cga ORF Vector (Rat) (pORF)

ORF064913 1.0 ug DNA
EUR 506.00

pGL3-Basic-CGA promoter Plasmid

PVTB80059-2a 2 ug
EUR 356.00

Rat Chromogranin(CgA)ELISA Kit

QY-E11087 96T
EUR 361.00

Mouse Chromogranin(CgA)ELISA Kit

QY-E20322 96T
EUR 361.00

CGA ELISA Kit (Human) (OKAN04321)

OKAN04321 96 Wells
EUR 792.00
Description: Description of target: The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. The protein encoded by this gene is the alpha subunit and belongs to the glycoprotein hormones alpha chain family. Two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.34 mIU/mL

CGA ELISA Kit (Human) (OKCD06874)

OKCD06874 96 Wells
EUR 635.00
Description: Description of target: The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. The protein encoded by this gene is the alpha subunit and belongs to the glycoprotein hormones alpha chain family. Two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.34mIU/mL

CGA ELISA Kit (Mouse) (OKCD06875)

OKCD06875 96 Wells
EUR 779.00
Description: Description of target: The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. The protein encoded by this gene is the alpha subunit and belongs to the glycoprotein hormones alpha chain family. Two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.82ng/mL

CGA ELISA Kit (Goat) (OKCA00590)

OKCA00590 96 Wells
EUR 728.00
Description: Description of target: ;Species reactivity: Goat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.25 uIU/mL

CGA ELISA Kit (Human) (OKCD07526)

OKCD07526 96 Wells
EUR 936.00
Description: Description of target: The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. The protein encoded by this gene is the alpha subunit and belongs to the glycoprotein hormones alpha chain family. Two transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.057ng/mL

CGA ELISA Kit (Mouse) (OKEH02958)

OKEH02958 96 Wells
EUR 414.00
Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 1.56uIU/mL

CGA ELISA Kit (Fish) (OKEH03759)

OKEH03759 96 Wells
EUR 479.00
Description: Description of target: ;Species reactivity: Fish;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.32mIU/mL

CGA ELISA Kit (Bovine) (OKEH03760)

OKEH03760 96 Wells
EUR 479.00
Description: Description of target: ;Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.22mIU/mL

CGA ELISA Kit (Dog) (OKEH03761)

OKEH03761 96 Wells
EUR 479.00
Description: Description of target: ;Species reactivity: Dog;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.2mIU/mL

CGA ELISA Kit (Pig) (OKEH07390)

OKEH07390 96 Wells
EUR 648.00
Description: Description of target: ;Species reactivity: Pig;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.2ng/mL

Chorionic Gonadotropin Alpha Polypeptide (CGa) Polyclonal Antibody (Human)

4-PAB612Hu01
  • EUR 239.00
  • EUR 2391.00
  • EUR 598.00
  • EUR 299.00
  • EUR 211.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: Leu25~Ser120
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Chorionic Gonadotropin Alpha Polypeptide (CGa)

Chorionic Gonadotropin Alpha Polypeptide (CGa) Polyclonal Antibody (Mouse)

4-PAB612Mu01
  • EUR 243.00
  • EUR 2457.00
  • EUR 613.00
  • EUR 305.00
  • EUR 212.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: CGa (Leu25~Ser120)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Chorionic Gonadotropin Alpha Polypeptide (CGa)

Chorionic Gonadotropin Alpha Polypeptide (CGa) Monoclonal Antibody (Human)

4-MAB612Hu22
  • EUR 247.00
  • EUR 2516.00
  • EUR 626.00
  • EUR 310.00
  • EUR 214.00
  • 0
  • 1
  • 2
  • 3
  • 4
  • Sequence of the immunogen: Inquire for antigen sequence.
  • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Mouse monoclonal antibody against Human Chorionic Gonadotropin Alpha Polypeptide (CGa)

Human CGA(Chromogranin A) ELISA Kit

EH0486 96T
EUR 524.10
  • Detection range: 0.781-50 ng/ml
  • Uniprot ID: P10645
  • Alias: CGA(Chromogranin A)
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.469 ng/ml

Human Chromogranin A(CgA)ELISA Kit

GA-E1747HM-48T 48T
EUR 289.00

Leave a Reply

Your email address will not be published. Required fields are marked *